Are you over 18 and want to see adult content?
More Annotations
A complete backup of evolutionmining.com.au
Are you over 18 and want to see adult content?
A complete backup of amedes-group.com
Are you over 18 and want to see adult content?
Favourite Annotations
A complete backup of www.indiatoday.in/technology/features/story/xiaomi-mi-10-series-launched-specifications-prices-and-everythi
Are you over 18 and want to see adult content?
A complete backup of www.tgcom24.mediaset.it/televisione/grande-fratello-vip-2020/gf-vip-la-canzone-dedica-di-federico-rossi-per
Are you over 18 and want to see adult content?
A complete backup of www.businesstoday.in/trending/box-office/love-aaj-kal-box-office-prediction-sara-ali-khan-kartik-aryan-roma
Are you over 18 and want to see adult content?
A complete backup of www.corrieredellosport.it/news/calcio/serie-a/2020/02/15-66762342/diretta_lecce-spal_ore_15_probabili_forma
Are you over 18 and want to see adult content?
Text
CONTESTGULLEY
In 1924, Henry Ford bought a patch of land in Dearborn, Michigan. Ford is often credited as a being far-seeing businessman, but in this case he was looking backward, not forward. On this corner of Dearborn, he started Greenfield Village, an homage to, in his words, the STUCK ON THE SOCIAL PLATEAU I'm always amused when I see somebody whose relationship status is set to "It's Complicated." More often than not, "It's Complicated" is a code phrase, a way of covering for a situation that's actually quite simple. For instance: "I have two girlfriends, but I can't say that out loud." It's not complicated, but it's gratifying ELVISH – RAMBLES BLOG AT STAR CHAMBER I was a serious Tolkien geek as a boy. Around sixth grade I taught myself the Elvish writing that Tolkien invented for the Lord of the Rings. In fact, he created both a language and a character set; these characters, you may recall, decorate the One Ring. If you don’t mess with the actual Elvish language, you can just use the beautiful characters to spell out English words. OUTSOURCING HUMANITY A cooking pot is an outsourced stomach. It shifts much of the burden of digesting food from inside to outside your body. Because of this, your real stomach doesn't have to work so hard. This was a big deal for early humans, allowing them to make EUCLIDEA: WINNING GEOMETRY In the future, everything will be gamified. That’s the premise of one of my favorite dystopian videos, Hyper-Reality.At times it may seem like we’re headed down that path, but in practice, a lot of life is pretty resistant to gamification. WASHING MACHINES LARGE AND SMALL Washing Machines Large and Small. Here is a picture of two different factories that do the same thing: turn atmospheric nitrogen into ammonia. The one on the left is a gigantic Haber process plant. It requires fantastic amounts of heat and pressure to do its work. Plants like this consume 3-5% of the entire world’s natural gas output. WHAT WAS HENRY FORD NOSTALGIC FOR? In 1924, Henry Ford bought a patch of land in Dearborn, Michigan. Ford is often credited as a being far-seeing businessman, but in this case he was looking backward, not forward. On this corner of Dearborn, he started Greenfield Village, an homage to, in his words, the "saner and sweeter time" he remembered as a THE VIRTUES OF INCREMENTALISM I came across a cartoon the other day. Maybe you've seen it too. This is my re-drawn version of it, to give you the general idea. A guy pulls up to a burger place in a big gas-guzzling car. Smoke pours from the tailpipe. He's about to take his order, but then he draws back: OPEN SOURCE MAKING, OPEN SOURCE MAINTAINING I enjoyed this Long Now talk by open source researcher Nadia Eghbal. If you can't be bothered to read her book, here's a good summary of what she's learned. Working in Public TL;DR: Nobody got into software because they love maintenance. Related: Nobody ever became a teacher because they love grading. I love one of FORVO, THE PRONUNCIATION WIKI There was a time, years ago, when even clever, well-informed programmers pronounced name of the operating system "Linux" much like the name of Charlie Brown's friend Linus. Lye-nix. One of the things that eventually set people straight on this (it was certainly the thing that set me straight) was a little audio recording of Linux RAMBLES BLOG AT STAR CHAMBERUNCATEGORIZEDENTRIES FEEDELVISHMATLABCONTESTGULLEY
In 1924, Henry Ford bought a patch of land in Dearborn, Michigan. Ford is often credited as a being far-seeing businessman, but in this case he was looking backward, not forward. On this corner of Dearborn, he started Greenfield Village, an homage to, in his words, the STUCK ON THE SOCIAL PLATEAU I'm always amused when I see somebody whose relationship status is set to "It's Complicated." More often than not, "It's Complicated" is a code phrase, a way of covering for a situation that's actually quite simple. For instance: "I have two girlfriends, but I can't say that out loud." It's not complicated, but it's gratifying ELVISH – RAMBLES BLOG AT STAR CHAMBER I was a serious Tolkien geek as a boy. Around sixth grade I taught myself the Elvish writing that Tolkien invented for the Lord of the Rings. In fact, he created both a language and a character set; these characters, you may recall, decorate the One Ring. If you don’t mess with the actual Elvish language, you can just use the beautiful characters to spell out English words. OUTSOURCING HUMANITY A cooking pot is an outsourced stomach. It shifts much of the burden of digesting food from inside to outside your body. Because of this, your real stomach doesn't have to work so hard. This was a big deal for early humans, allowing them to make EUCLIDEA: WINNING GEOMETRY In the future, everything will be gamified. That’s the premise of one of my favorite dystopian videos, Hyper-Reality.At times it may seem like we’re headed down that path, but in practice, a lot of life is pretty resistant to gamification. WASHING MACHINES LARGE AND SMALL Washing Machines Large and Small. Here is a picture of two different factories that do the same thing: turn atmospheric nitrogen into ammonia. The one on the left is a gigantic Haber process plant. It requires fantastic amounts of heat and pressure to do its work. Plants like this consume 3-5% of the entire world’s natural gas output. WHAT WAS HENRY FORD NOSTALGIC FOR? In 1924, Henry Ford bought a patch of land in Dearborn, Michigan. Ford is often credited as a being far-seeing businessman, but in this case he was looking backward, not forward. On this corner of Dearborn, he started Greenfield Village, an homage to, in his words, the "saner and sweeter time" he remembered as a THE VIRTUES OF INCREMENTALISM I came across a cartoon the other day. Maybe you've seen it too. This is my re-drawn version of it, to give you the general idea. A guy pulls up to a burger place in a big gas-guzzling car. Smoke pours from the tailpipe. He's about to take his order, but then he draws back: OPEN SOURCE MAKING, OPEN SOURCE MAINTAINING I enjoyed this Long Now talk by open source researcher Nadia Eghbal. If you can't be bothered to read her book, here's a good summary of what she's learned. Working in Public TL;DR: Nobody got into software because they love maintenance. Related: Nobody ever became a teacher because they love grading. I love one of FORVO, THE PRONUNCIATION WIKI There was a time, years ago, when even clever, well-informed programmers pronounced name of the operating system "Linux" much like the name of Charlie Brown's friend Linus. Lye-nix. One of the things that eventually set people straight on this (it was certainly the thing that set me straight) was a little audio recording of Linux RAMBLES BLOG AT STAR CHAMBER In 1924, Henry Ford bought a patch of land in Dearborn, Michigan. Ford is often credited as a being far-seeing businessman, but in this case he was looking backward, not forward. On this corner of Dearborn, he started Greenfield Village, an homage to, in his words, the “saner and sweeter time” he remembered as a boy. RAMBLES BLOG AT STAR CHAMBER Clean energy is going to save us. Oh no, wait! Clean energy is going down the tubes.Maybe nuclear energy ia the next big thing after all. Oh, right, except for the earthquake that vaporized all political support for nuclear power.But maybe thorium fission is the magic we’ve been looking for. Or maybe not.. I tell you, these hype cyclesare exhausting.
EVERYTHING IS GETTING BETTER AND WORSE AT THE SAME TIME Everything is getting better and worse at the same time. “The truth will set you free, but first it will make you miserable.”. It’s late at night. You shuffle to the kitchen for a snack. Your hand fumbles briefly for the light switch, and roaches! They quickly scatter, but now you’ve seen them. A MODERN MAGICAL SPELL A Modern Magical Spell. Double, double toil and trouble; Fire burn and cauldron bubble. Everyone knows what a magic spell is. Say the words and things will happen. With the right incantation, you may see the future. Harm your foe. Ward off evil. You generally need more than just words to make the magic happen.FEBRUARY 2021
Welcome to February, and happy 139th birthday James Joyce! Groundhog Day is a cross-quarter day, halfway from solstice to equinox. I think of the quarter days (solstices and equinoxes) as being pivot days for heat, and cross-quarter days as being pivot days for light. OPEN SOURCE MAKING, OPEN SOURCE MAINTAINING I enjoyed this Long Now talk by open source researcher Nadia Eghbal. If you can't be bothered to read her book, here's a good summary of what she's learned. Working in Public TL;DR: Nobody got into software because they love maintenance. Related: Nobody ever became a teacher because they love grading. I love one of TOILET SEATS AND CARDBOARD SAWS I love my toilet seat. Some product are so well designed that they bring delight every single time you use them. My toilet seat is a slow-close toilet seat. That means I don't have to worry about it slamming down with an ear-splitting BANG! I don't have to lower it with anxious care. Just giveOCTOBER 2002
I always enjoyed the book Science Made Stupid, a parody science book.The writing is hit-and-miss, mostly relying on goofy sound-alike puns (the three kinds of rock are ignominious, sedentary, and metaphoric).Enough of the writing hits the target to make you believe the author, Tom Weller, is truly (or was trained as) a scientist. MAY 1999 – RAMBLES BLOG AT STAR CHAMBER 2 posts published by gulley during May 1999. Part 42: Signs of Soda by Wally. We were one sunrise away from watching the reddish glow of the evening sun color the rim of the Grand Canyon, and one sunset away from the first light of daybreak over Zabriske Point, in Death Valley.JANUARY 1998
2 posts published by gulley during January 1998. Happy 1998. Have you read “Into Thin Air” by Jon Krakauer yet? As far as my highly scientific survey can tell, soon every man, woman, and child in the country will have either read it, heard it aloud, or been lectured toat length about it
RAMBLES BLOG AT STAR CHAMBERUNCATEGORIZEDENTRIES FEEDELVISHMATLABCONTESTGULLEY
Mosquitoes are a problem, but what can you do about it? If you can’t just screen them off, then you’ll need poison: insecticide. Insecticide is a dumb technology in the sense that it can’t discriminate between different types of insects, and also in the sense that you have to put it everywhere the mosquitoes might be, since you don’t know where they are. OUTSOURCING HUMANITY A cooking pot is an outsourced stomach. It shifts much of the burden of digesting food from inside to outside your body. Because of this, your real stomach doesn't have to work so hard. This was a big deal for early humans, allowing them to make ELVISH – RAMBLES BLOG AT STAR CHAMBER I was a serious Tolkien geek as a boy. Around sixth grade I taught myself the Elvish writing that Tolkien invented for the Lord of the Rings. In fact, he created both a language and a character set; these characters, you may recall, decorate the One Ring. If you don’t mess with the actual Elvish language, you can just use the beautiful characters to spell out English words. WASHING MACHINES LARGE AND SMALL Here is a picture of two different factories that do the same thing: turn atmospheric nitrogen into ammonia. The one on the left is a gigantic Haber process plant. It requires fantastic amounts of heat and pressure to do its work. Plants like this consume 3-5% of THE VIRTUES OF INCREMENTALISM I came across a cartoon the other day. Maybe you've seen it too. This is my re-drawn version of it, to give you the general idea. A guy pulls up to a burger place in a big gas-guzzling car. Smoke pours from the tailpipe. He's about to take his order, but then he draws back: WHAT DO YOU DO ABOUT UNHAPPIVERSARIES? My wife was diagnosed with pancreatic cancer on the day before Thanksgiving in 2018. It made for a somber meal the next day. In the two years since then, my stomach has tightened just before Thanksgiving. I call occasions like this unhappiversaries. Anniversaries of trauma. Maybe it's the death of a parent. Or themotorcycle
FORVO, THE PRONUNCIATION WIKI There was a time, years ago, when even clever, well-informed programmers pronounced name of the operating system "Linux" much like the name of Charlie Brown's friend Linus. Lye-nix. One of the things that eventually set people straight on this (it was certainly the thing that set me straight) was a little audio recording of Linux MARCH 1997 – RAMBLES BLOG AT STAR CHAMBER Scientific progress seems to accelerate the very pace of time itself. The arrival of Dolly, the cloned sheep from Scotland, proves this beyond any doubt: two shakes of a lamb’s tail now requires half thetime it used to.
NOVEMBER 1999
Q: Who were the Hittites? A: Now that’s a rarely asked question. During the second millennium B.C. the Indo-European people known as the Hittites ruled over the “Land of Hatti,” in central and eastern Anatolia (the peninsula which is modern Turkey).JANUARY 1999
by St. Frank. The other day I was walking back to work at lunchtime in downtown Oakland. This being California, it was sunny and mild, and I caught sight of a guy in front of an office building enjoying acigarette.
RAMBLES BLOG AT STAR CHAMBERUNCATEGORIZEDENTRIES FEEDELVISHMATLABCONTESTGULLEY
Mosquitoes are a problem, but what can you do about it? If you can’t just screen them off, then you’ll need poison: insecticide. Insecticide is a dumb technology in the sense that it can’t discriminate between different types of insects, and also in the sense that you have to put it everywhere the mosquitoes might be, since you don’t know where they are. OUTSOURCING HUMANITY A cooking pot is an outsourced stomach. It shifts much of the burden of digesting food from inside to outside your body. Because of this, your real stomach doesn't have to work so hard. This was a big deal for early humans, allowing them to make ELVISH – RAMBLES BLOG AT STAR CHAMBER I was a serious Tolkien geek as a boy. Around sixth grade I taught myself the Elvish writing that Tolkien invented for the Lord of the Rings. In fact, he created both a language and a character set; these characters, you may recall, decorate the One Ring. If you don’t mess with the actual Elvish language, you can just use the beautiful characters to spell out English words. WASHING MACHINES LARGE AND SMALL Here is a picture of two different factories that do the same thing: turn atmospheric nitrogen into ammonia. The one on the left is a gigantic Haber process plant. It requires fantastic amounts of heat and pressure to do its work. Plants like this consume 3-5% of THE VIRTUES OF INCREMENTALISM I came across a cartoon the other day. Maybe you've seen it too. This is my re-drawn version of it, to give you the general idea. A guy pulls up to a burger place in a big gas-guzzling car. Smoke pours from the tailpipe. He's about to take his order, but then he draws back: WHAT DO YOU DO ABOUT UNHAPPIVERSARIES? My wife was diagnosed with pancreatic cancer on the day before Thanksgiving in 2018. It made for a somber meal the next day. In the two years since then, my stomach has tightened just before Thanksgiving. I call occasions like this unhappiversaries. Anniversaries of trauma. Maybe it's the death of a parent. Or themotorcycle
FORVO, THE PRONUNCIATION WIKI There was a time, years ago, when even clever, well-informed programmers pronounced name of the operating system "Linux" much like the name of Charlie Brown's friend Linus. Lye-nix. One of the things that eventually set people straight on this (it was certainly the thing that set me straight) was a little audio recording of Linux MARCH 1997 – RAMBLES BLOG AT STAR CHAMBER Scientific progress seems to accelerate the very pace of time itself. The arrival of Dolly, the cloned sheep from Scotland, proves this beyond any doubt: two shakes of a lamb’s tail now requires half thetime it used to.
NOVEMBER 1999
Q: Who were the Hittites? A: Now that’s a rarely asked question. During the second millennium B.C. the Indo-European people known as the Hittites ruled over the “Land of Hatti,” in central and eastern Anatolia (the peninsula which is modern Turkey).JANUARY 1999
by St. Frank. The other day I was walking back to work at lunchtime in downtown Oakland. This being California, it was sunny and mild, and I caught sight of a guy in front of an office building enjoying acigarette.
STUCK ON THE SOCIAL PLATEAU I'm always amused when I see somebody whose relationship status is set to "It's Complicated." More often than not, "It's Complicated" is a code phrase, a way of covering for a situation that's actually quite simple. For instance: "I have two girlfriends, but I can't say that out loud." It's not complicated, but it's gratifying THE VIRTUES OF INCREMENTALISM I came across a cartoon the other day. Maybe you've seen it too. This is my re-drawn version of it, to give you the general idea. A guy pulls up to a burger place in a big gas-guzzling car. Smoke pours from the tailpipe. He's about to take his order, but then he draws back:FEBRUARY 2020
1 post published by gulley during February 2020 MAY 1996 – RAMBLES BLOG AT STAR CHAMBER 2 posts published by gulley during May 1996. Divination, that intuitive art that uncovers and foretells, comes in a multitude of forms, from reading tea leaves and Tarot cards to inspecting the entrails of sacrificial animals (popular in ancient Rome, though perhaps not with the RSPCA).SEPTEMBER 1997
3 posts published by gulley during September 1997. Jumping the gun a little on Halloween, memories of strange stories shared with old friends inspire this week’s Star Chamber.THE EARLIEST SUNSET
Living at 42 degrees north latitude (Boston, Massachusetts) I am jealous of the winter sunshine. I am sorry to see it depart and I am happy to see it return. If you're like me and you live at a similar latitude, you'll be glad to know that today is the earliest sunset. InBoston on
AUGUST 1998
Brother Blue says, "My father used to tell stories to God, tears pouring down his face." Brother Blue is a storyteller of some fame, a jazz-riffing peacock of a performer, a first class wordconjuror and a fine harmonica player.NOVEMBER 2012
2 posts published by gulley during November 2012. Yowza! I’ve seen the Museum of Bad Art (I’ve even seen it in person, since it’s in Somerville). And I’ve seen mediocre art by famous people like Richard Feynman.I’ve seen the primitive folk art of Grandma Moses.But I’ve never these things all rolled together into onemagical package.
JUNE 2000 – RAMBLES BLOG AT STAR CHAMBER Many of the applets at bewitched are beautiful, but the shortcut wins the prize. It’s visual treat that keeps you watching till the very end. Incidentally, the guy behind the work (Martin Wattenberg) also does the SmartMoney Map of the Market visualization, which is an honest-to-goodness jewel of interface design.. Along the same lines as the bewitched.com site, here are some of my favoriteJANUARY 1999
by St. Frank. The other day I was walking back to work at lunchtime in downtown Oakland. This being California, it was sunny and mild, and I caught sight of a guy in front of an office building enjoying acigarette.
Skip to content
RAMBLES BLOG AT STAR CHAMBER EUCLIDEA: WINNING GEOMETRY In the future, everything will be gamified. That’s the premise of my favorite dystopian video, Hyper-Reality . At times it may seem like we’re headed down that path, but in practice, a lot of life is pretty resistant to gamification. Life kind of sucksthat way.
Source:
https://imgur.com/gallery/PhGtj It’s not like it’s going to be possible to turn your math homework into a fun game. Or is it? I was intrigued this weekend to see that anapp called Euclidea
was a top puzzle
game in Apple’s App Store. Euclidea is based on proving propositions in Euclidean geometry. The fact that they turned Euclid’s Elementsinto a highly
rated iPad game reeled me in. I downloaded it. Sure enough, it’s pretty great. Can it deliver on the notion of being fun while helping you actually get better at geometry? I think it can. For each level, you’re given a proposition to demonstrate (“Construct the tangent line through a point on a circle”). Your job is not only to provide the necessary demonstration, but to do it in optimal ways. This can be tricky. I was pleased with myself for solving one of the problems easily enough: _inscribe a square inside a circle_. But then they had the temerity to assert that my solution was bloated. In fact, you could find the solution with exactly seven elementary steps: either using a compass or a straightedge, but nothing else. Or so they said. I convinced myself that this wasimpossible.
Fortunately, I know how to play (cheat at) games in the modern age. YouTube will always tell you what you need to know, and after I beat my head against the problem for a while, I gave in. This video did the trick. Sometimes you cheat and you feel bad. _I could have figured that out if I wasn’t so lazy._ But sometimes you cheat and you realize that you’ve been schooled in something altogether new, something you were never going to discover on your own. This was one of those situations. I was impressed. Spoiler: Here’s what my screen looked like after I cheated. Seven magic steps I never would have found without YouTube This raises a question: if it’s so easy to cheat, if YouTube is always one click away, then who will bother to learn? This is exactly why gamification becomes so important. It gives you the story, the motivation to pay attention to the cheat video when it finally comes. On my own, I didn’t find the optimal solution to the inscribed square problem, but I watched carefully and was amazed when I finally saw it demonstrated. No other pedagogical approach would have glued me in place quite so thoroughly. I call this _cheating your way to mastery_. It’s a real thing, and it works. More than that, it’s a prominent feature of our age. Remember, the problem isn’t cheating. The problem is being sufficiently motivated to learn. Incidentally, the idea of using modern graphics and UI to explore planar geometry has been around for a long time. One good example is the Geometer’s Sketchpad . Sadly, it was acquired by a textbook company, so it was promoted as an instructional tool rather than an explorational game. It never achieved the widespread audience it deserved. I hope Euclidea will go farther. Author gulley Posted on June1, 2021June 2, 2021
Categories
Uncategorized Leave a comment on Euclidea: Winning Geometry WHAT WAS HENRY FORD NOSTALGIC FOR? In 1924, Henry Ford bought a patch of land in Dearborn, Michigan. Ford is often credited as a being far-seeing businessman, but in this case he was looking backward, not forward. On this corner of Dearborn, he started Greenfield Village, an homage to, in his words, the “saner and sweeter time” he remembered as a boy. For this village-as-museum, he collected old buildings along with the artifacts that would have been used in them: a carriage barn, a cider mill, a blacksmith’s shed. But the prize dwelling on the site, at least from Ford’s point of view, was his boyhood home. He had had it moved and re-fashioned to be exactly as it had been when he was thirteen. That was 1876, the year his mother died. To realize this vision, to make this old house rise from the ashes, he had agents scour the countryside for all the items he recalled from youth: the rugs, the dinner plates, the silverware, the wood stove, the pump organ, and on and on. We all get nostalgic for our younger days, but Ford’s obsession is noteworthy for a few reasons. First, he had the money to pursue this nostalgia with an unmatchable intensity. Next, it turns out that he had never cared for farm life as a boy. He hated the work, dreamed of using automation to make it go away, and escaped from it as quickly as he could. Finally, and most significantly, he did more than anyone else on the planet to destroy the “simple” agrarian world of his youth and bring about the greasy, smoky mechanical age. To sum up: at great expense, Henry Ford built a museum to commemorate a time he hadn’t liked, and which he subsequently bulldozed over acliff.
This question fascinates me: What, exactly, was Henry Ford nostalgic for? Did he feel guilty? Did he experience dreams of something real that had been, or were they instead the lopsided projections of memory theater? I think of the “real” Greenfield Village as a girl he broke up with in high school. Imagine we track her down today. Life has been hard for her, and it shows. She says “Ha! So old Henry Ford says he loved me, huh? Well he sure had a funny way of showing it. He did everything he could to drive me away. And now he’s built this shrine to what? To me? To something that never existed. I don’t know who that is, but it isn’t me.” What does nostalgia enable, and what does it block? Memory can be a wonderful celebration, but it can also be a loaded gun. It can carry an implied curse at the present, a maudlin memorialization of a golden past that never was, a rejection of the Now that was already immanent in the Then. Whenever you toast the past, be sure to tip your hat tothe present.
_(And by the way, I learned about Greenfield Village in Richard Snow’s excellent book I Invented the Modern Age: The Rise of HenryFord
.
I recommend it.)_
Author gulley Posted on May 24, 2021May 24, 2021Categories
Uncategorized Leave a comment on What Was Henry Ford Nostalgic For? CUTE FORCE, NOT BRUTE FORCE: THE GNOMES ARE COMING! Mosquitoes are a problem, but what can you do about it? If you can’t just screen them off, then you’ll need poison: insecticide. Insecticide is a dumb technology in the sense that it can’t discriminate between different types of insects, and also in the sense that you have to put it everywhere the mosquitoes _might _be, since you don’t know where they are. In other words, you need too much to have enough. But dumping loads of poison mostly in the wrong place kills lots of beneficial insects too. And because poisons build up in the environment, you end killing much larger animals too. You’re whacking the ecosystem with a baseball bat. Brute force. But suppose you could hire some clever gnomes whose job was to listen for mosquitoes, and then shoot them dead with tiny crossbows whenever they came near? Assuming these gnomes are good at their job, you wouldn’t need too many of them to make a big difference. Instead of ladling gallons of neurotoxin indiscriminately across everything in the neighborhood (children, pets, garden vegetables, honeybees), you just deploy a few mosquito-sniping gnomes in strategic locations. Instead of brute force, call it cute force. What I want to tell you today is that the gnomes are coming. The Photonic Fence , though still in early development, is a real thing. It promises to bring you a sharp-shooting cohort of pesticidal gnome-bots. Cameras can spot the mosquitoes, and low-powered lasers can then shoot them from the sky like tiny anti-aircraft cannons. The big idea behind cute force is simple: smart, cheap devices that can identify and eliminate whatever is undesired (like killing bugs) or retrieve whatever is desired (like picking fruit). And it’s all being enabled by cheap AI and robotics. Compared to what they can replace, gnomes are (or soon enough will be) cheap. Doing things cleverly and one-at-a-time scales better than you think. You’re going to start seeing gnomes everywhere. The brute-force approach shows up a lot in agriculture. Consider the problem of weeding. To get rid of the bad plants, the current strategy is to kill all plants. On a conventional farm, this is done with a broad-acting plant poison called Roundup (glyphosate). Organic farms can’t use Roundup, but look what they do instead. It may seem a little medieval, but they literally scorch the earth with propane torches to kill all plants. This meets the guidelines for organic farming, although it’s clearly not great for the atmosphere. Either way, you’re wiping out everything in your path, with significant collateral damage. Suppose instead you could hire some clever weeding gnomes who knew the difference between good plants and bad plants? There are dozens of companies working on exactly this problem. Some of them use lasers. Some use robotic
arms
.
Some use spinning string-trimmers. Some still
use herbicide
, but 95%
less of it because it gets applied exactly where it’s needed. The breakthrough products haven’t arrived yet, but they will. The tech is getting cheaper every day. Robots never need to sleep, and they can eliminate the need for tons of expensive and dangerous chemicals. Once you start thinking about problems like this, you see them everywhere. Here’s a Dutch company killing moths with drones.
Or why not detect and zap cancerous cells one at a time in the bloodstream to prevent metastasis? Or how about building smart nets that only catch the kind of fish you want? And then there is, of course, the topic of warfare, which is more or less defined by the concept of eliminating undesirable things. Explosives are the ultimate expression of brute force. Why be so wasteful and destructive if you can just land a small killbot drone in exactly the right place? On a less grim note, you wouldn’t need to force all cars to get (easily evaded) emissions inspections every year if you had a reliable network of gnomes who could quickly detect and ticket offending vehicles onthe roads.
The gnomes are coming! Some of them are already here. You can even buy this little green garden gnome today to patrol your pepper patch. Author gulley Posted on May 17, 2021May 17, 2021Categories
Uncategorized
RENEWABLE ENERGY LEVERAGE California recently hit 95% renewable energy sources for its electrical power generation. Great news! Enthusiasts will want to bang the drum, but skeptics will observe that this record comes with a number of conditions. “High water marks” like this happen at particular times of day during particular times of year. At this point in the calendar, the daylight hours are abundant and temperatures are still moderate enough to keep demand relatively low. A calm, hot day in the summer will look very different. And the picture changes dramatically as we leave California. The total nationwide contribution of solar to electricity production, for example, is still less than 3%. Wind is less than 10%.Source: US
EIA via Wikipedia
Despite these relatively low percentages, I want to show how much leverage renewables (coupled with batteries) can have on the market even when their relative contributions are quite small. One dramatic example of this is from a hot summer day in Australia back in 2019. In the last few years, Australia has installed some of the world’s largest grid-connected batteries. Nevertheless, in terms of the overall electrical market, they are tiny. And they’re quite expensive. So how can they turn a profit? Watch this. December 19th of 2019 was extraordinarily hot,
so electrical demand for cooling was high. As the sun set, solar power generation dropped away. As luck would have it, winds were calm. This led to a shortfall in power generation as natural gas and diesel assets were ramping up. This, in turn, caused the spot price for electricity to jump briefly to $14,700/MWh. And who was in a position to claim that price? The big batteries at Hornsdale and Lake Bonney. In just two days, these batteries earned $1 million.
Source:
Renew Economy
The picture tells the story. You can see that the thin sliver of battery capacity captured most of the attractive profits before the fossil-fuel generators could cough to life. The key is speed. Batteries can instantaneously discharge their power in response to market conditions. They are the nimble mammals dodging between the legs of the lumbering dinosaurs. In the first four months of operation, the Hornsdale battery with 2 per cent of the capacity in South Australia claimed 55 per cent of the revenues in South Australia.
This is terrible news for natural gas and diesel peaker plants. One of the reasons peaker plants exist is because they can capture this very profit. Someone needs to pay for all that idle time when they sit around playing cards, waiting for a call from grid manager. From the point of view of fossil fuels, renewable plus battery is a brutal one-two punch. Solar pushes down your prices all day long while the sun is smiling, and then, just when you can taste those delicious sunset profits, a zippy little battery swoops in and gobbles them up. So even in their current diminutive form, renewables cast a long shadow over the future of fossil-fuel power generation. Building a new gas plant is so expensive that you need to count on consistent profits for many years. With the growth of cheap renewables, the capital needed to build a fossil-fuel plant gets more and more expensive. Bankers, it turns out, just hate loaning money that might never getpaid back.
The bottom line is that renewables are already having an outsized effect on the overall market. They punch above their weight, and they are continually trending up. I’m looking forward to more “highwater mark” days.
Author gulley Posted on May10, 2021
Categories
Uncategorized
THINKING ABOUT NOTHING: STUFF AND NEGA-STUFF I once read an article about the phantom traffic jams that seem to crop up at random. So there’s no accident or road closure, just a wicked knot that mysteriously slows you to a crawl, and then just as mysteriously lets you go. It turns out that, once traffic reaches a critical volume, it only takes one person stomping on the brakes to form that knot, and then it might take an hour or more to clear. If you’re stuck in a jam like this, what can you do about it? The author had a ready answer: feed it space. I understood what he meant. Don’t crowd the car in front of you. But I also like how he put it. Feed nothing into the traffic jam. Turning nothing into something, or turning inaction into an action, can be an extraordinarily effective brain tool. In the semiconductor physics that govern things like transistors, scientists find it useful to talk about electrons, which are bona fide things, and “holes”, which are the places where electrons aren’t. Holes are notional particles of non-particle-ness, a convenient shorthand that comes about when we refer to the absence of something as something. You can see this phenomenon many places. A vacuum is another example. The vacuum isn’t sucking things into it. The vacuum is the absence of pushing. But we find it convenient to talk about a vacuum as a thing that sucks. It’s not a logical flaw so much as a reframing that simplifies our reasoning. My favorite example of positive negation comes in the energy industry. Imagine you’re running a power grid in Hotsylvania. It’s a scorching day in July and everyone has their air conditioners on. As more demand comes online, you have to switch on more power plants. What else can you do? As it happens, there is an alternative. Let’s further suppose that you’ve set up a demand management program in which customers agree to decrease their demand at your request. Here is the key insight: from your point of view as the system operator, _a “negative power plant” that reduces demand is just as useful as a positive power plant that increases supply_. They both do the same thing to the energy balance equation. And once you make this conceptual breakthrough, it’s easy to see that not building a new power plant is likely to be much cheaper than building a new powerplant.
Amory Lovins , founder of the Rocky Mountain Institute , referred to unrealized energy efficiency as “negawatts”. It’s the amount of power you might NOT use. Negawatts let you reason about loss and inefficiency as a “thing”, such that you might be able to do something about it. He liked to say that the United States is the Saudi Arabia of negawatts. If you can find a way to make money out of inefficiency, then negawatts become a resource that can make you rich. We’ve got heaps of the stuff. Lovins applied this logic to the U.S. car industry, pointing out that our big petroleum-powered cars represent a huge negawatt reserve. Using the geological terminology of the oil extraction business, he called this the “Detroit Formation.” If you can sell a more efficient vehicle, and these days it’s clear you can, then you can make a fortune by tapping into the negawatts buried deep underDetroit.
Thinking about nothing as something doesn’t really change anything physical. But it makes new thinking possible. I even find it useful in the kitchen. If I want to eat less, instead of moaning that I can’t eat anything, I make a positive message: I can eat all the nothing I want. I’m consuming nega-calories. Or to return to the story about how to fix the traffic jam, instead of saying “Don’t drive fast”, I can say “Feed the jam some lovely space.” Obviously the outcome is the same, but I prefer the second message. It matters because it makes a difference to my brain, and so it makes a difference to my behavior. We almost always want to solve our problems with more stuff. But often the most effective solution is with nega-stuff. Author gulley Posted on May3, 2021
Categories
Uncategorized
CEREAL BOX ARMS RACE Cereal boxes, much like the competing trees in a tropical rain forest, need radiation to survive. For trees this radiation comes from the sun. For cereal boxes, you provide the _attention radiation_ that illuminates and nourishes them. This so-called “att-rad” can lead to the next stage of the cereal box life cycle, grocery cartosis, in which harvested goods are placed in the cart and transported out of the store. Cartosis is followed by deposition in the kitchen cabinet reticulum for storage, and ultimately consumption by the human host. Competition for att-rad is, therefore, a deadly serious business, and much studied by consumer ecologists at organizations such as Unilever, Proctor & Gamble, and Frostie-Krunch Consolidated Heavy Carbohydrates,Inc.
One especially valuable and selected-for trait in the cereal aisle canopy is box height. Here we see the mighty Special-K box towering over a nearby companion. The monster in this picture was measured at close to 340 millimeters! On the shelves of the cereal forest, that diverse and superheated environment where boxes are harvested, this trait serves it well. Taller boxes appear to attract more of the precious and life-bestowing attention radiation from potential humanhosts.
But beware! All phenotypes have maladaptive tradeoffs. The tall trees of the rain forest must cope with the hazard of being so tall that they pitch over in the wind. And this noble Special K box now finds itself in the awkward position of being poorly adapted for storage in the cabinet reticulum of the host’s kitchen-plasm. It’s too tall for its new home! To circumvent this problem, the fruit of the Special K box has been grafted onto a sturdy wild-type Chex box, as close inspection of this image will reveal. The Crispix fruit has suffered a similar fate. This cross-grafting can be an irritant to the humanhost.
Ultimately, box height comes at a steep ecological price. Here we see the remains of the box exoskeleton cast off into the recycling compost of the kitchen floor. All the energy that went into the box will now be passed to that ravenous detrivore, the recycling bin (_Receptaclus cardboardi_). Box height is energetically expensive, and it can irritate the human host, who must prematurely shuck and discard this extravagant cereal integument and then graft the fruit to a surrogate species. All to chase the fickle attention radiation that beams daily from your eyes. Is it worth it? Is this a stable and successful reproductive strategy? Evolutionary time will tell. Author gulley Posted on April 26, 2021April 26, 2021Categories
Uncategorized
EVERYTHING IS GETTING BETTER AND WORSE AT THE SAME TIME _“The truth will set you free, but first it will make youmiserable.”_
It’s late at night. You shuffle to the kitchen for a snack. Your hand fumbles briefly for the light switch, and… roaches! They quickly scatter, but now you’ve seen them. You know they’re there. From now on, you can’t not think about the roaches in the kitchen. It’s a shame, too, because you always thought of yourself as a neat person with a clean kitchen. But now that image has been ruined. The good news is, now you have better information about the world. You DO have roaches in your kitchen, and you can start to do something aboutit.
The Roach Reveal story is how I think about one of our modern patterns of experience: _everything is getting better and worse at the same time_. These days we’re getting ever more powerful sensors that show us the virtual vermin that lurk beneath the veneers of civilization. We’re seeing roaches we never knew were there. It feels like we’re being hammered endlessly by terrible news. But look closer: the roaches were always there. And now we can start to do something about it. And often it’s only when we realize just how bad it is that we finally decide to take action. Related to this topic, I want to convince you to read The AlignmentProblem
by Brian Christian. This book addresses the dangers associated with machine learning, smart robots, and clever algorithms of all kinds. The title refers to a subtle and disturbing fact: it’s strangely difficult to tell a computer what you want it to do. You can tell it to do something that is what you THINK you want it to do. And then it will, with dizzying speed and precision, set about making you miserable, all while doing exactly what you asked. This is often described in terms of deal-with-the-devil jokes: tell the computer to stop people from getting malaria, and it will murder everyone before they can catch malaria. “I solved your problem!” says the robot. “You killed my family!” says the programmer. That’s the alignment problem. It’s not a joke. One of the topics in the book is algorithmic bias. Suppose you want to teach a robot to hire good employees. Or decide who should get a loan. Or maybe decide who should be paroled from jail. After you implement some pretty straightforward machine learning, you are almost certain to be disturbed by the results. The computer has learned from a horribly biased society. What else could it learn from? Naturally it mirrors back to us racism, sexism, and xenophobia. Machine learning is the kitchen light. It’s illuminating the roaches that have been crawling through our brains and institutions for hundreds of years. Switching on these algorithms feels like a massive step backwards. We are in danger of encoding extraordinarily efficient prejudice. But the book comes with good news too. No matter how unhappy the kitchen light first makes you, it will also help you solve the problem. Seeing how biased our algorithms are, we can set about attacking the root cause. The root cause is not the kitchen light. Our computers can teach us to be better humans. Author gulley Posted on April 12, 2021April 15, 2021Categories
Uncategorized
HOW DO YOU SPELL VACCINE? This post is a follow-up to one that I did back in February: A ModernMagical Spell
. There I
was ruminating about the fact that, whereas old-school vaccines included little chunks of the virus itself, the Pfizer and Moderna mRNA vaccines are instructions, blueprints, that tell your body how to make those little viral chunks. They are, in effect, cellular DIYprojects.
It sounds like a minor point, but the difference is huge. Sending messages is easier and more flexible than sending the thing that the message encodes. Why send cookies if you can just send the recipe? Why send a string quartet if you can just send the sheet music? Blueprints are cheaper than bricks. Anyway, I’m writing about the same thing again because we now know exactly what text is in the vaccine. Text messages are convenient for a number of reasons, and one is that they’re easy for us to read. Think about this: the syringe that pokes you in the arm is a bottle with a message. Uncork the bottle, unroll the message, and you can see, you can just read off, exactly what protein sequence the vaccine codes for. Some folks at Stanford have done exactly that: Stanford Scientists Post mRNA Sequence for Moderna Vaccine on Github.
They didn’t want to get in trouble for stealing anyone’s shot, so they did the equivalent of sifting through the trash for valuable documents: _“RNAs were obtained as discards from the small portions of vaccine doses that remained in vials after immunization.”_ Pfizer didn’t want to publish this information… only they _did _publish it. They published millions of copies into little vials and distributed them across the country. For my previous piece, I made a guess as to the sequence that was used for encoding the spike protein. No surprise, my guess was wrong. But the good news is that the actual answer is posted on GitHub. Check out the fancy title: Assemblies of putative SARS CoV2 spike encoding mRNA sequences for vaccines BNT-162b2 and mRNA-1273.
Do you want to know the actual recipe for that BNT-162b2 vaccine? The actual text that would be injected into your bloodstream? Here it is. GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACCATGTTCGTGTTCCTGGTGCTGCTGCC TCTGGTGTCCAGCCAGTGTGTGAACCTGACCACCAGAACACAGCTGCCTCCAGCCTACACCAACAGCTTTACCAGAGGCG TGTACTACCCCGACAAGGTGTTCAGATCCAGCGTGCTGCACTCTACCCAGGACCTGTTCCTGCCTTTCTTCAGCAACGTG ACCTGGTTCCACGCCATCCACGTGTCCGGCACCAATGGCACCAAGAGATTCGACAACCCCGTGCTGCCCTTCAACGACGG GGTGTACTTTGCCAGCACCGAGAAGTCCAACATCATCAGAGGCTGGATCTTCGGCACCACACTGGACAGCAAGACCCAGA GCCTGCTGATCGTGAACAACGCCACCAACGTGGTCATCAAAGTGTGCGAGTTCCAGTTCTGCAACGACCCCTTCCTGGGC GTCTACTACCACAAGAACAACAAGAGCTGGATGGAAAGCGAGTTCCGGGTGTACAGCAGCGCCAACAACTGCACCTTCGA GTACGTGTCCCAGCCTTTCCTGATGGACCTGGAAGGCAAGCAGGGCAACTTCAAGAACCTGCGCGAGTTCGTGTTTAAGA ACATCGACGGCTACTTCAAGATCTACAGCAAGCACACCCCTATCAACCTCGTGCGGGATCTGCCTCAGGGCTTCTCTGCT CTGGAACCCCTGGTGGATCTGCCCATCGGCATCAACATCACCCGGTTTCAGACACTGCTGGCCCTGCACAGAAGCTACCT GACACCTGGCGATAGCAGCAGCGGATGGACAGCTGGTGCCGCCGCTTACTATGTGGGCTACCTGCAGCCTAGAACCTTCC TGCTGAAGTACAACGAGAACGGCACCATCACCGACGCCGTGGATTGTGCTCTGGATCCTCTGAGCGAGACAAAGTGCACC CTGAAGTCCTTCACCGTGGAAAAGGGCATCTACCAGACCAGCAACTTCCGGGTGCAGCCCACCGAATCCATCGTGCGGTT CCCCAATATCACCAATCTGTGCCCCTTCGGCGAGGTGTTCAATGCCACCAGATTCGCCTCTGTGTACGCCTGGAACCGGA AGCGGATCAGCAATTGCGTGGCCGACTACTCCGTGCTGTACAACTCCGCCAGCTTCAGCACCTTCAAGTGCTACGGCGTG TCCCCTACCAAGCTGAACGACCTGTGCTTCACAAACGTGTACGCCGACAGCTTCGTGATCCGGGGAGATGAAGTGCGGCA GATTGCCCCTGGACAGACAGGCAAGATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGGCTGTGTGATTGCCT GGAACAGCAACAACCTGGACTCCAAAGTCGGCGGCAACTACAATTACCTGTACCGGCTGTTCCGGAAGTCCAATCTGAAG CCCTTCGAGCGGGACATCTCCACCGAGATCTATCAGGCCGGCAGCACCCCTTGTAACGGCGTGGAAGGCTTCAACTGCTA CTTCCCACTGCAGTCCTACGGCTTTCAGCCCACAAATGGCGTGGGCTATCAGCCCTACAGAGTGGTGGTGCTGAGCTTCG AACTGCTGCATGCCCCTGCCACAGTGTGCGGCCCTAAGAAAAGCACCAATCTCGTGAAGAACAAATGCGTGAACTTCAAC TTCAACGGCCTGACCGGCACCGGCGTGCTGACAGAGAGCAACAAGAAGTTCCTGCCATTCCAGCAGTTTGGCCGGGATAT CGCCGATACCACAGACGCCGTTAGAGATCCCCAGACACTGGAAATCCTGGACATCACCCCTTGCAGCTTCGGCGGAGTGT CTGTGATCACCCCTGGCACCAACACCAGCAATCAGGTGGCAGTGCTGTACCAGGACGTGAACTGTACCGAAGTGCCCGTG GCCATTCACGCCGATCAGCTGACACCTACATGGCGGGTGTACTCCACCGGCAGCAATGTGTTTCAGACCAGAGCCGGCTG TCTGATCGGAGCCGAGCACGTGAACAATAGCTACGAGTGCGACATCCCCATCGGCGCTGGAATCTGCGCCAGCTACCAGA CACAGACAAACAGCCCTCGGAGAGCCAGAAGCGTGGCCAGCCAGAGCATCATTGCCTACACAATGTCTCTGGGCGCCGAG AACAGCGTGGCCTACTCCAACAACTCTATCGCTATCCCCACCAACTTCACCATCAGCGTGACCACAGAGATCCTGCCTGT GTCCATGACCAAGACCAGCGTGGACTGCACCATGTACATCTGCGGCGATTCCACCGAGTGCTCCAACCTGCTGCTGCAGT ACGGCAGCTTCTGCACCCAGCTGAATAGAGCCCTGACAGGGATCGCCGTGGAACAGGACAAGAACACCCAAGAGGTGTTC GCCCAAGTGAAGCAGATCTACAAGACCCCTCCTATCAAGGACTTCGGCGGCTTCAATTTCAGCCAGATTCTGCCCGATCC TAGCAAGCCCAGCAAGCGGAGCTTCATCGAGGACCTGCTGTTCAACAAAGTGACACTGGCCGACGCCGGCTTCATCAAGC AGTATGGCGATTGTCTGGGCGACATTGCCGCCAGGGATCTGATTTGCGCCCAGAAGTTTAACGGACTGACAGTGCTGCCT CCTCTGCTGACCGATGAGATGATCGCCCAGTACACATCTGCCCTGCTGGCCGGCACAATCACAAGCGGCTGGACATTTGG AGCAGGCGCCGCTCTGCAGATCCCCTTTGCTATGCAGATGGCCTACCGGTTCAACGGCATCGGAGTGACCCAGAATGTGC TGTACGAGAACCAGAAGCTGATCGCCAACCAGTTCAACAGCGCCATCGGCAAGATCCAGGACAGCCTGAGCAGCACAGCA AGCGCCCTGGGAAAGCTGCAGGACGTGGTCAACCAGAATGCCCAGGCACTGAACACCCTGGTCAAGCAGCTGTCCTCCAA CTTCGGCGCCATCAGCTCTGTGCTGAACGATATCCTGAGCAGACTGGACCCTCCTGAGGCCGAGGTGCAGATCGACAGAC TGATCACAGGCAGACTGCAGAGCCTCCAGACATACGTGACCCAGCAGCTGATCAGAGCCGCCGAGATTAGAGCCTCTGCC AATCTGGCCGCCACCAAGATGTCTGAGTGTGTGCTGGGCCAGAGCAAGAGAGTGGACTTTTGCGGCAAGGGCTACCACCT GATGAGCTTCCCTCAGTCTGCCCCTCACGGCGTGGTGTTTCTGCACGTGACATATGTGCCCGCTCAAGAGAAGAATTTCA CCACCGCTCCAGCCATCTGCCACGACGGCAAAGCCCACTTTCCTAGAGAAGGCGTGTTCGTGTCCAACGGCACCCATTGG TTCGTGACACAGCGGAACTTCTACGAGCCCCAGATCATCACCACCGACAACACCTTCGTGTCTGGCAACTGCGACGTCGT GATCGGCATTGTGAACAATACCGTGTACGACCCTCTGCAGCCCGAGCTGGACAGCTTCAAAGAGGAACTGGACAAGTACT TTAAGAACCACACAAGCCCCGACGTGGACCTGGGCGATATCAGCGGAATCAATGCCAGCGTCGTGAACATCCAGAAAGAG ATCGACCGGCTGAACGAGGTGGCCAAGAATCTGAACGAGAGCCTGATCGACCTGCAAGAACTGGGGAAGTACGAGCAGTA CATCAAGTGGCCCTGGTACATCTGGCTGGGCTTTATCGCCGGACTGATTGCCATCGTGATGGTCACAATCATGCTGTGTT GCATGACCAGCTGCTGTAGCTGCCTGAAGGGCTGTTGTAGCTGTGGCAGCTGCTGCAAGTTCGACGAGGACGATTCTGAG CCCGTGCTGAAGGGCGTGAAACTGCACTACACATGATGACTCGAGCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTT TCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCT CTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAG CAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGCA
There it is! That’s the payload. That’s what the fuss is all about. It gives me a thrill to look at it. It may look like a mess, but the ribosomes in your cells can read it like a recipe. So we might say that you can’t read it, but “you” can. Because you can. And you will. And it might save your life. As biology becomes more and more of an information science, many strange and wonderful things will become possible. We’re still at the “Mr. Watson, come here, I want to see you” stage ofcommunication.
Author gulley Posted on April 5, 2021April 7, 2021Categories
Uncategorized
OUTSOURCING HUMANITY A cooking pot is an outsourced stomach. It shifts much of the burden of digesting food from inside to outside your body. Because of this, your real stomach doesn’t have to work so hard. This was a big deal for early humans, allowing them to make more effective use ofavailable food.
Consider the shift that followed. Over millions of years, animals slowly evolved stomachs that could digest their preferred diet. This internal stomach is encoded in DNA, in the genome. Then, one fine day, fire-savvy, cook-capable humans came along. The job of the stomach could now be shared between the pot and the belly, which means that the combined “big stomach” is now a joint venture encoded by both genetic and cultural DNA. Across many generations, the biological stomach can now “relax”. Not only does it do less work, it can even give up some its ability to do the hard work of digesting raw food. Why bother, as long as you have a microwave handy? In this sense, you become a hybrid biological-cultural construct, as dependent on the cultural knowledge of cooking and pot-making as on your own self-constructing DNA. How long would you survive naked in thewilderness?
What’s true for cooking is true for many things. Knives outsource teeth. Clothes outsource skin. Glasses outsource vision. We make our tools and our tools make us. It’s an obvious statement and a profound one, particularly when you consider medicine. Across the millennia, pathogens have sculpted our genome. Traits that have helped previous generations survive the ravages of malaria, plague, and tuberculosis get built into our genes. We have the tracks of thousands of pandemics etched into our genetic memory.
But now, just as with our stomachs and our teeth, we are outsourcing, externalizing our immune system. This modern plague is reshaping not so much our genetics as our global cultural medical apparatus. Pfizer, Moderna, and AstraZeneca can do in one year what a deadly plague might have needed a hundred years and fifty million lives to impart to our genes. Our genes don’t need to improve so long as our medical care does. Put another way, our biological immune system is now free to get weaker, so long as biotechnology can carry its load. It doesn’t take a great leap of imagination to see us, across several hundred years, fading into our sustaining machinery. With it, we are gods. Without it, we are shrieking infants. But the coming world will also give us the ability to upgrade not only our machines, but also our genes. Here’s one simple example of what that might look like. As noted, traits that are not needed for survival tend to fade. This is why you can’t smell as well as a dog. You share with dogs a lot of the same DNA for sensing specific odors, but in humans, much of this DNA has been damaged and rendered inert. If a few bulbs burn out in your smell-o-nator, who cares? You can still have healthy kids. Over time, humans have lost the cunning of the canine nose. But that doesn’t have to be true forever. We can not only build outsourced spectrometers and mechanical noses, we will also be able to retrofit our DNA. This will be a dangerous and subtle skill to learn, but be certain it will come. In the future, wealthy parents will be able to endow their offspring with, among other things, the smelling capabilities of dog. I don’t know if that’s a good idea, but I’m telling you, it’s coming. Would you pay to give your children a superhuman sense of smell? Or the ability to see colors no human ever saw? Author gulley Posted on March 29, 2021April 2, 2021Categories
Uncategorized
STRAVA HEATMAPS ON THE CHEAP Strava has been wildly successful at getting people to surrender their privacy in the name of bragging about fitness. You log your activity on the Strava website, and from this you can make personalized maps. You can even share this information up into a global heatmap database,
from which Strava can show you where EVERYBODY has been running and biking and snowshoeing and paragliding and dolphin-riding and so on. It’s a lot of fun to play around with. Shown below, we’re zoomed in on Cambridge and Boston. It’s no surprise that busy streets are busy, but I like how you can see exactly where the gaps are under the Harvard Bridge. The Charles River looks like a highway. Which, for the purposes of sport (and fish), it is. I was jealous of these personal activity maps, but not jealous enough to spend the money on Strava. That was when I remembered something important, something that I try to remind myself on a regular basis: whenever you imagine a potential app or web service, you cause somebody to retroactively make it for you. That is to say, your idea isn’t original, so someone has already done it for you. All you have to do is say “All-seeing Google, show me the thing that does X.” As in the sentence: “Show me the site that will let me make my own Strava-like heatmaps for free.” I know this is kind of obvious, but sometimes I forget to actually make a pointed request for something that is vaguely floating around in my mind. I’m kind of thinking about it (“gee, that Strava heatmap is cool…”), but I don’t articulate the specific question. This means that the app never gets retroactively created by internet elves on my behalf. You see how it works? The magic neverhappens.
Anyway, I was not disappointed. I was led very quickly t0 dériveby Erik Price
. It’s free! It’s open source (MIT license)! It’s very good, and it works like a charm. Huzzah! How I love the new millennium. And thank you, Erik. You just bring your own GPX files to the dérive website, and then drag them onto the browser. All the work happens in the browser, so you’re not actually sending any of the files back up to the site. This pandemic has given me a lot of time to walk around my hometown, and my completionist tendencies coupled with a nice route-planning app (Footpath ) have given me the motivation toexplore.
How it started:
How it’s going:
You’d be amazed how many roads are close to you that you’ve neverbeen on.
Author gulley Posted on March 22, 2021March 22, 2021Categories
Uncategorized
POSTS NAVIGATION
Page 1 Page 2 … Page 166Next page
Search for: Search
RECENT POSTS
* Euclidea: Winning Geometry * What Was Henry Ford Nostalgic For? * Cute Force, Not Brute Force: The Gnomes Are Coming! * Renewable Energy LeverageRECENT COMMENTS
Seth P on What Do You Do About Unhappive… gulley on A Modern Magical SpellCraig Pleasants on
A Modern Magical Spell gulley on Ode to a CalculatorLINKS
* MATLAB Contest
READING
READING: READ
Liftoff: Elon Musk and the Desperate Early Days That Launched SpaceXby Eric Berger
The Alignment Problem: Machine Learning and Human Valuesby Brian Christian
Enemy of All Mankind: A True Story of Piracy, Power, and History's First Global Manhuntby Steven Johnson
Seizing The Enigma: The Race To Break The German U-boat Codes,1939-1943
by David Kahn
Human Compatible: Artificial Intelligence and the Problem of Controlby Stuart Russell
Share book reviews
and ratings with Ned, and even join a book club on Goodreads.My Tweets
ARCHIVES
* June 2021 (1)
* May 2021 (4)
* April 2021 (3)
* March 2021 (5)
* February 2021 (5) * January 2021 (2) * September 2020 (2)* August 2020 (1)
* July 2020 (3)
* May 2020 (1)
* February 2020 (1) * January 2020 (3) * February 2018 (1) * January 2018 (2) * October 2017 (1) * September 2017 (1) * December 2016 (1)* August 2016 (2)
* July 2016 (2)
* June 2016 (4)
* May 2016 (5)
* April 2016 (2)
* May 2014 (1)
* January 2014 (2) * December 2013 (2) * November 2013 (2) * October 2013 (3) * September 2013 (3)* August 2013 (3)
* July 2013 (2)
* June 2013 (3)
* May 2013 (2)
* April 2013 (1)
* March 2013 (4)
* February 2013 (4) * January 2013 (3) * December 2012 (3) * November 2012 (2) * October 2012 (4) * September 2012 (5)* August 2012 (4)
* July 2012 (3)
* June 2012 (4)
* May 2012 (5)
* April 2012 (4)
* March 2012 (4)
* February 2012 (6) * January 2012 (4) * December 2011 (3) * November 2011 (5) * October 2011 (5) * September 2011 (7)* August 2011 (4)
* July 2011 (4)
* June 2011 (7)
* May 2011 (5)
* April 2011 (4)
* March 2011 (9)
* February 2011 (4) * January 2011 (6) * December 2010 (6) * November 2010 (5) * October 2010 (7) * September 2010 (4)* August 2010 (8)
* July 2010 (6)
* June 2010 (6)
* May 2010 (7)
* April 2010 (8)
* March 2010 (7)
* February 2010 (7) * January 2010 (7) * December 2009 (9) * November 2009 (7) * October 2009 (7) * September 2009 (7)* August 2009 (8)
* July 2009 (6)
* June 2009 (9)
* May 2009 (8)
* April 2009 (7)
* March 2009 (8)
* February 2009 (8) * January 2009 (7) * December 2008 (8) * November 2008 (8) * October 2008 (9) * September 2008 (9)* August 2008 (8)
* July 2008 (8)
* June 2008 (10)
* May 2008 (7)
* April 2008 (11)
* March 2008 (7)
* February 2008 (9) * January 2008 (10) * December 2007 (6) * November 2007 (8) * October 2007 (10) * September 2007 (9)* August 2007 (8)
* July 2007 (9)
* June 2007 (9)
* May 2007 (11)
* April 2007 (8)
* March 2007 (11)
* February 2007 (10) * January 2007 (11) * December 2006 (11) * November 2006 (11) * October 2006 (11) * September 2006 (10)* August 2006 (9)
* July 2006 (7)
* June 2006 (11)
* May 2006 (9)
* April 2006 (5)
* March 2006 (10)
* February 2006 (11) * January 2006 (9) * December 2005 (8) * November 2005 (9) * October 2005 (11) * September 2005 (12) * August 2005 (11)* July 2005 (9)
* June 2005 (10)
* May 2005 (13)
* April 2005 (10)
* March 2005 (12)
* February 2005 (12) * January 2005 (11) * December 2004 (7) * November 2004 (12) * October 2004 (8) * September 2004 (11) * August 2004 (12)* July 2004 (17)
* June 2004 (15)
* May 2004 (14)
* April 2004 (12)
* March 2004 (13)
* February 2004 (10) * January 2004 (12) * December 2003 (11) * November 2003 (12) * October 2003 (11) * September 2003 (11) * August 2003 (11)* July 2003 (10)
* June 2003 (8)
* May 2003 (12)
* April 2003 (10)
* March 2003 (9)
* February 2003 (10) * January 2003 (15) * December 2002 (11) * November 2002 (12) * October 2002 (11) * September 2002 (9) * August 2002 (16)* July 2002 (11)
* June 2002 (18)
* May 2002 (19)
* April 2002 (15)
* March 2002 (15)
* February 2002 (20) * January 2002 (14) * December 2001 (13) * November 2001 (15) * October 2001 (15) * September 2001 (16) * August 2001 (21)* July 2001 (15)
* June 2001 (21)
* May 2001 (18)
* April 2001 (22)
* March 2001 (15)
* February 2001 (31) * January 2001 (26) * December 2000 (27) * November 2000 (15) * October 2000 (5) * September 2000 (13) * August 2000 (20)* July 2000 (5)
* June 2000 (1)
* April 2000 (2)
* March 2000 (1)
* January 2000 (3) * November 1999 (2) * September 1999 (2)* August 1999 (1)
* June 1999 (1)
* May 1999 (2)
* April 1999 (1)
* March 1999 (1)
* February 1999 (2) * January 1999 (2) * December 1998 (2) * November 1998 (2) * October 1998 (2) * September 1998 (1)* August 1998 (2)
* June 1998 (2)
* May 1998 (1)
* April 1998 (1)
* March 1998 (1)
* February 1998 (1) * January 1998 (2) * December 1997 (2) * September 1997 (3)* August 1997 (2)
* June 1997 (2)
* May 1997 (1)
* March 1997 (4)
* January 1997 (1) * December 1996 (2) * November 1996 (2) * October 1996 (4) * September 1996 (2)* August 1996 (1)
* July 1996 (3)
* May 1996 (2)
* April 1996 (4)
META
* Register
* Log in
* Entries feed
* Comments feed
* WordPress.com
Rambles Blog at Star Chamber Blog atWordPress.com.
Rambles Blog at Star Chamber Blog at WordPress.com.Write a Comment...
Email (Required) Name (Required) WebsiteLoading Comments...
Comment
×
* FollowFollowing
* Rambles Blog at Star Chamber*
Already have a WordPress.com account? Log in now.*
* Rambles Blog at Star Chamber* Customize
* FollowFollowing
* Sign up
* Log in
* Report this content * Manage subscriptions* Collapse this bar
Details
Copyright © 2024 ArchiveBay.com. All rights reserved. Terms of Use | Privacy Policy | DMCA | 2021 | Feedback | Advertising | RSS 2.0